Toxoplasma gondii is an obligate intracellular coccidian parasite widely distributed in the world (1). Patients with HM, including those with acute myelogenous leukemia, and those who have undergone hematopoietic stem cell transplantation or are treated with aggressive immunosuppressive regimens are at high risk of opportunistic infections Prompt Correct diagnosis is essential for the effective management of possible infections (2)

In individuals with a normal immune system, T. gondii infection is usually asymptomatic (latent) and harmless and often passes unnoticed; however, in immunosuppressed and immunodeficient individuals (e.g., patients with AIDS, patients receiving hemodialysis, organ transplant recipients, and patients receiving chemotherapy for cancer), it is complicated and fatal, if not treated (3,4,5).

 Human infection is caused by the ingestion of cysts in undercooked meat or oocysts in contaminated food or water. Infection may be also transmitted congenitally or through organ transplantation (3). After initial dissemination, the parasite can evade the immune system and persist throughout the host life within dormant cysts, predominantly in the brain, retina, and muscles (6). Patients with neoplasia, collagen tissue disease, transplant recipients under immunosuppressive therapy, or hemodialysis patients with chronic renal failure have deficient cellular immunity, and this makes them susceptible to the infection ⁽⁷⁾. In immunocompromised patients, the infection most often involves the nervous system, with diffuse encephalopathy, meningoencephalitis, or cerebral mass lesions ⁽⁸⁾.

Subjects and Methods: One hundred and thirty (80 men, 50 women) patients with neoplastic disorders and liver disease under immunosuppressive treatment, presented to Erbil and Nanakali Teaching     Hospitals.  Faculty Oncology, Haematology, and Hepatology Department, during the period from May 2023 to the end of January 2024. Fifty healthy volunteers (19 men, and 31 women) were included in the study. The age of the patient group was 16 to 82 with a mean age of 53.37692, St. Deviation ± 12.022 and 18 to 80 with a mean age of 50.34, St. Deviation ± 12.40738 in the control group

Blood was taken from all patients under sterile conditions and was centrifuged at 1000 r.p.m. and the sera separated. The sera were stored at -20 C^o until tested.

Patients:

The patients included in this study were selected from Erbil and Nanakali hospitals in Erbil. All the patients were asked for age, sex, residence, occupation, history of medical diseases, and drug treatment.

The patients studied were divided into the following groups.

A-Hematological Malignant patients

 Seventy patients with Haematological malignant, with a mean age of 54.9429, St. Deviation ± 13.96153,    were treated with immunosuppressive drugs with one or more of the following agents: steroid, alkylating agents, and antimetabolite. All of these were treated for malignant diseases. And based on histological examination of an excised lymph gland, or bone marrow aspiration on diagnosis.

1. colon cancer without immunosuppressive drugs

In this study 27 patients with colon cancer, with a mean age of 52.4074, St. Deviation ±   10.27790, were not under immunosuppressive drugs.

1. Liver diseases with corticosteroid treatment

 Serum samples were taken from patients thirty-three with liver disease under observation in the hepatology polyclinic of the gastroenterology Clinic, with a mean age of 50.8485, St. Deviation of 7.98483.  They receive corticosteroids as a treatment.

Control:

Blood samples were obtained from fifty healthy individuals. They were from different places in Erbil governorate, their age ranged from 18 up to 80 years, with mean age 50.3400 and St. Deviation ± 12.40738. Information regarding age, sex, and socio-economic status was obtained from every individual. However, with a strong emphasis on not reporting any evidence of diseases in their medical and drug history before the events of this study, by forms of scrutinized history taking, and professional medical reporting from their medical therapists.

Molecular diagnosis [18]: DNA was extracted from the anticoagulated blood samples using QIAamp DNeasy Mini kit (Qiagen cat. no. U.S.69504 and 69506) according to the manufacturer’s directions. Amplification of Toxoplasma 529re gene was performed in a thermal cycler (Beco, Germany) using the primers TOXO 4: 5'CGCTGCAGGGAGGAAGACGAAAGTTG3' and TOXO 5: 5′CGCTGCAGACACAGTGCATCTGGATT-3′[18]. The primers were synthesized by Fermentas (Fermentas UAB, Lithuania). The PCR reaction was performed using Red Taq master mix (Bioline, UK). The amplification steps included an initial denaturation step at 94°C for 5 min, 35 cycles of denaturation at 94°C for 45 sec, annealing at 55°C for 30 sec, and extension at 72°C for 45 sec, and a final extension step at 72°C for 10 min. The PCR final products were separated in 1% agarose gel electrophoresis at 100 v for 30 min. The bands of the expected size were visualized against a 100 bp DNA ladder on a UV transilluminator. Each PCR round included a negative control of nuclease-free water and a positive control of DNA extracted from T. gondii RH strain maintained in the Parasitology Department, Medical Research Institute, Alexandria University.

Table (3.1) Mean and standard deviation of patients and control study groups.

Table (3.2) shows the percentage of positive Toxoplasma gondii IgG antibodies in study groups. The percentage of Toxoplasma gondii IgG antibodies in the hematological malignant group, liver diseases group, colon cancer group, and control were 57.1%, 51.5%, 25.9%, and 18% respectively.  The difference was statistically significant between the hematological group and the control (P< 0.05) and also between the liver disease group and the control (P< 0.05) but was not statistically significant between the colon cancer group and control group (P > 0.05).

Table (3.2) Percentage of positive Toxoplasma gondii IgG antibodies in study groups.

Table (3.3) Shows the percentage of positive Toxoplasma gondii IgM antibodies in study groups. The percentage of Toxoplasma gondii IgM antibodies in the hematological malignant group, liver diseases group, colon cancer group, and control were 12.9%, 0%, 3.7%, and 2% respectively. The difference was statistically significant between the hematological group and control (P< 0.05) but was not statistically significant between the liver disease group and control   (P> 0.05), and also was not statistically significant between the colon cancer group and the control group (P > 0.05).

Table (3.3) Percentage of positive Toxoplasma gondii IgM antibodies in study groups.

Percentage of seropositive (IgM &/ or IgG) by ELISA method in cancer patients compared to the healthy individuals (Control Group).The percentage of seropositive in cancer patients was 58.76 % and 20% in the control gro

up, The difference was statistically significant between the Patients group and the control (P< 0.05)

3.5 Percentage of molecular detection of T. gondii (PCR) in cancer patients compared to healthy individuals.

The percentage of positive PCR results in cancer patients was 52.57 while positive PCR results in the control group showed 10%, The difference was statistically significant between the cancer and control groups (P< 0.05)

3.6 Percentage of serological positive and molecular detection of T. gondii (PCR) in cancer patients and control group

Compare percentage positive in cancer patients by using the ELISA method for the detection of seropositive T.gondii was 58.76, in compare to molecular detection by PCR was 52.57, while the results for the control group was 20%  seropositive by  ELISA method compared to PCR method was 10%, so there was no statistic significant difference between using ELISA method or PCR for detection T. gondii .

3.7 Percentages of positive Toxoplasma gondii gondii   IgG and IgM   antibodies in hematological malignant groups.

Table (3.7) shows the percentage of T.gondii   IgG and IgM antibodies in hematological malignant groups. There was no statistically significant difference in the rate of positive T. gondii IgG antibodies among malignant groups (p>0.05). However there was a statistically significant difference in the rate of positive T. gondii IgM antibodies among hematological malignant groups (p< 0.05). 

Table (3.7) Percentage of positive T.gondii   IgG and IgM antibodies in  hematological malignant groups.

Table (3.8) shows the percentage of sex distribution among patients. In the patients group the

percentage of female with positive IgG  Toxoplasma gondii antibodies(52% )was more than the percentage of males with positive  IgG  Toxoplasma gondii antibodies (47.5%) but there was no statistically significant difference (p>0.05).       

Chi-square (X ²) 0.25     P values 0.617 

Table (3.8) Sex distribution among the patients with positive IgG Toxoplasma gondii antibodies

 Table (3.9)) shows the percentage of sex distribution among the control group. In the control, the percentage of females with positive IgG Toxoplasma gondii antibodies (19.4% )was more than the percentage of males with positive  IgG Toxoplasma gondii antibodies (15.8%) but there was no statistically significant difference (p>0.05).

Chi-square (X ²) 0.10     P values 1

The intracellular protozoon, T. gondii is recognized as an opportunistic parasite in immunocompromised patients [9]. The immune system plays a critical role in controlling and clearing parasitic infections (10). Hence, those with weakened immune systems, such as immunocompromised individuals, including patients with cancer, may become infected with life-threatening opportunistic infections such as toxoplasmosis (11).

The results of the present study represent serodignosis of  IgG and IgM Toxoplasma gondii using (ELISA) in four groups, hematological malignant under immunosuppressive treatment, liver disease under steroid treatment, colon cancer and control groups in two hospitals in Erbil governorate.

The present results revealed higher percentages of positivity for   T. gondii  IgG antibodies  in patients more than control, hematological malignant (57.1% ), liver disease (51.5%), colon cancer (25.9%), and control (18.0) respectively with a statistically significant difference         P value  (<0.05) between hematological and control groups and also between liver diseases and control while P value (> 0.05) between colon cancer and control groups  Table (3.2) While, table (3.3) show, seropositive of  T.gondii IgM antibodies among the same groups, hematological malignant(12.9%), liver diseases (0%), colon cancer (3.7%), and control (2%)  respectively with a statistically significant difference   P value 0.024 (<0.05) between hematological and control groups while P value (>0.05)between liver disease and control and also between colon cancer and control groups

The present results revealed higher percentages of seropositivity for T. gondii  (IgM +IgG)  in cancer patients (58.76%) compared with the controls (20%) with a statistically significant difference P value 0.00 Table (3.4). The percentages of positivity for      T. gondii  by PCR   in cancer patients (52.57%) compared with the controls (10 %) was statistically significant P value 0.00 (<0.05). This is attributed to weak immune systems in patients with cancer, which may facilitate the reactivation of previous chronic toxoplasmosis or even increase the potential risk of acquiring new infections (12) Close to our results, in two previous global (13, 14) systematic review and meta-analysis studies, the IgG seropositivity against T. gondii was 30.8% and 42.1%, respectively. Similarly, in another systematic review conducted in Iran (15), In Egypt, seroprevalence rates as high as 90% and as low as 20% were previously reported among patients with other forms of malignancy[16-17. A meta-analysis incorporating nineteen studies conducted in China with a total of 4493 patients and 6797 controls concluded that the overall T. gondii seroprevalence was significantly higher in the population with cancer compared to those without (20.59% vs 6.31%)[18]. These findings may be because patients with neoplasia are immunocompromised, which increases their susceptibility to this infection ⁽¹⁹⁾.

Our results shows seropositive of  IgG antibodies in Hodgkin's (65.38%), non Hodgkin's (52.94%)  and  leukemia  (51.81%)  respectively  we performed statistical  analysis to  determine the positivity rates of         anti-T. gondii  IgG antibodies in each neoplasia patient group. The results were not statistically significant (P>0.05), table (3. 7) the percentage of IgM antibodies in Hodgkin's (7.9%) non Hodgkin's (0%) and leukemia (25.92%) respectively and p-value was (0.02). Our results agreed with S. Yazar et al., They found that they was not statistically significant difference in the rate of positive T. gondii IgG antibodies among neoplasia groups, Hodgkin's, non-Hodgkin's and leukemia (68.0%),(60.0%) and (66.7%)respectively and (P value > 0.05). This fits to our results ⁽¹⁹⁾.  Another study show by Ziguo Yuanin et al., in 2006 in China, determined anti – Toxoplasma antibodies in tow hundred and sixty-seven(116 men, 151 women)in different types of cancer patients, they had found that there was no statistically significant difference in the rate of positive T. gondii  IgG antibodies between nasopharyngeal carcinoma group and rectal cancer group, or among the other malignant groups P value > 0.05⁽²⁰⁾.  This was in agreement with our results.  Altintas in 1983 found that positive T.gondii  IgG antibodies in Hodgkin's and non-Hodgkin's disease was 42.8 %⁽²¹⁾, and Gungor et al., 1993 in USA, they found in acute leukemia patients 63.3 % with positive IgG(²²⁾.

The higher seropositivity of anti-T. gondii antibodies among HM patients compared to healthy individuals may be attributed to the weakened host immunity. In acute leukemia, immune dysfunction results from abnormal maturation and dysregulated proliferation of leukocytes and significant bone marrow infiltration. Additionally, the presence of a large number of immature myeloid cells can inhibit antigen-specific T cell responses[23].

In chronic leukemias, the main underlying pathology is the accumulation and slow proliferation of mature appearing but functionally incompetent leukocytes. The B cell defects lead to hypogammaglobulinemia involving the three classes; IgG, IgA, and IgM(24,25) Impaired functions of natural killer cells, neutrophils, monocytes, and macrophages were recorded[24]. The T cell defects interfere with the initiation and maintenance of the immune response(26) In HCL that has a slow progressing course, neutropenia and monocytopenia increase susceptibility to infection[24], and all treatment regimens can further exacerbate immunosuppression in all types of HM(27). In HCL that has a slow progressing course, neutropenia and monocytopenia increase susceptibility to infection[23], and all treatment regimens can further exacerbate immunosuppression in all types of HM[2].

The results in Tables (3.8),(3.9shows the percentage of positive IgG antibodies in females(52%) more than in males(47.5%) in the patients group, but was not statistically significant  (P- -value = 0.617), also the percentage of positive   IgG antibodies in females(19.4%) more than males(15.8%) in Control group, but was not a statistically significant difference  (P- value=1). A similar result was observed by Carmen Studeničová et al,. In   2003, in Slovakia ⁽²⁸⁾. They found that  32.4%  IgG positive in females and 22.4%  IgG in males,no significant differences between genders  (p = 0.079), this agrees with our study. Similar results were reported in previous studies[29].⁾.  

1. The study shows that the rate of IgG Toxoplasma gondii antibodies seropositivity was highly prevalent, with statistically significant differences, among patients with hematological malignant and immunosuppression from controls.
2. The highest percentage of IgG and IgM gondii antibodies seropositivity was seen in hematological malignant patients with a statistically significant difference from the control group.
3. The highest percentage of IgG gondii antibodies seropositivity was among patients and controls more than 50 years.
4. Female shows the highest percentage of IgG gondii positive antibodies than males.

4.3 Recommendations

1. Future studies need to be done on larger patients and control samples, including different groups of immunocompromised patients.
2. Evaluation of the role of Toxoplasma gondii on immunocompromised groups and it is a complication.
3. The study of the relationship between Toxoplasma gondii and each type of malignant.
4. Introducing the newly used test PCR for the detection of toxoplasma antigen present in CSF and blood. PCR may also be useful in diagnosing extracerebral toxoplasmosis and detecting reactivation of latent cerebral toxoplasmosis.  

1. Abdel-Rahman, M.A.M. "Toxoplasmosis in Man and Animals." Egyptian Journal of Chemical and Environmental Health, vol. 3, no. 2, 2017, pp. 54-73.
2. Christopeit, M., et al. "Prophylaxis, Diagnosis, and Therapy of Infections in Patients Undergoing High-Dose Chemotherapy and Autologous Haematopoietic Stem Cell Transplantation: 2020 Update of the Recommendations of the Infectious Diseases Working Party (AGIHO) of the German Society of Haematology and Medical Oncology (DGHO)." Annals of Hematology, vol. 100, no. 2, 2021, pp. 321-336. https://doi.org/10.1007/s00277-020-04307-7.
3. Conrad, A., et al. "A Matched Case–Control Study of Toxoplasmosis after Allogeneic Haematopoietic Stem Cell Transplantation: Still a Devastating Complication." Clinical Microbiology and Infection, vol. 22, no. 7, 2016, pp. 636-641. https://doi.org/10.1016/j.cmi.2016.04.010.
4. Zadeh, A.E., et al. "Toxoplasmosis as a Complication of Transfusion in Hemodialysis Patients." Iranian Journal of Pediatric Hematology and Oncology, vol. 4, no. 1, 2014, pp. 22-25.
5. Bajnok, J., et al. "High Frequency of Infection of Lung Cancer Patients with the Parasite Toxoplasma gondii." ERJ Open Research, vol. 5, no. 2, 2019, 00143-2018. https://doi.org/10.1183/23120541.00143-2018.
6. Vidal, J.E. "HIV-Related Cerebral Toxoplasmosis Revisited: Current Concepts and Controversies of an Old Disease." Journal of the International Association of Providers of AIDS Care, vol. 18, 2019, 2325958219867315. https://doi.org/10.1177/2325958219867315.
7. Yazar, S., et al. "Anti-Toxoplasma gondii Antibodies in Patients with Neoplasia." Journal of Medical Microbiology, vol. 53, 2004, pp. 1183-1186. https://doi.org/10.1099/jmm.0.45550-0.
8. Garcia, L.S., and Bruckner, D.A. "Parasitic Infections in the Compromised Host (Toxoplasma gondii)." Diagnostic Medical Parasitology, edited by L.S. Garcia and D.A. Bruckner, 3rd ed., American Society for Microbiology, 1997, pp. 111-121.
9. Hill, D.E., and Dubey, J.P. "Toxoplasma gondii." Foodborne Parasites, edited by Y.R. Ortega and C.R. Sterling, 2nd ed., Springer, 2018, pp. 119-138. https://doi.org/10.1007/978-3-319-95294-0_7.
10. Garung, P., and Kanneganti, T.D. "Immune Responses against Protozoan Parasites: A Focus on the Emerging Role of Nod-like Receptors." Cellular and Molecular Life Sciences, vol. 73, no. 16, 2016, pp. 3035-3051. https://doi.org/10.1007/s00018-016-2226-5.
11. Wang, Z.D., et al. "Toxoplasma gondii Infection in Immunocompromised Patients: A Systematic Review and Meta-Analysis." Frontiers in Microbiology, vol. 8, 2017, p. 389. https://doi.org/10.3389/fmicb.2017.00389.
12. Ali, M.I., et al. "Toxoplasma gondii in Cancer Patients Receiving Chemotherapy: Seroprevalence and Interferon Gamma Level." Journal of Parasitic Diseases, vol. 43, no. 3, 2019, pp. 464-471. https://doi.org/10.1007/s12639-019-01110-0.
13. Anvari, D., et al. "Seroprevalence of Toxoplasma gondii Infection in Cancer Patients: A Systematic Review and Meta-Analysis." Microbial Pathogenesis, vol. 129, 2019, pp. 30-42. https://doi.org/10.1016/j.micpath.2019.02.031.
14. Ahmadpour, E., et al. "Toxoplasmosis in Immunocompromised Patients in Iran: A Systematic Review and Meta-Analysis." Journal of Infection in Developing Countries, vol. 8, no. 12, 2014, pp. 1503-1510. https://doi.org/10.3855/jidc.4872.
15. El Shazly, A., et al. "Antibodies against Toxoplasma in Children and Adults with Malignancy." Journal of the Egyptian Society of Parasitology, vol. 26, no. 3, 1996, pp. 781-787.
16. Abdel-Malek, R., et al. "Toxoplasmosis an Overlooked Disease: Seroprevalence in Cancer Patients." Asian Pacific Journal of Cancer Prevention, vol. 19, no. 7, 2018, pp. 1987-1991. https://doi.org/10.22034/APJCP.2018.19.7.1987.
17. Jiang, C., et al. "The Seroprevalence of Toxoplasma gondii in Chinese Population with Cancer: A Systematic Review and Meta-Analysis." Medicine, vol. 94, no. 50, 2015, e2274. https://doi.org/10.1097/MD.0000000000002274.
18. Yazar, S., et al. "Investigation of Anti-Toxoplasma gondii Antibodies in Patients with Neoplasia." Journal of Medical Microbiology, vol. 53, 2004, pp. 1183-1186. https://doi.org/10.1099/jmm.0.45610-0.
19. Yuan, Z., et al. "Toxoplasma gondii Antibodies in Cancer Patients." Cancer Letters, vol. 254, 2007, pp. 71-74. https://doi.org/10.1016/j.canlet.2007.02.009.
20. Altintas, K. "Hodgkin ve Non-Hodgkin Lenfomali Vakalarda Toxoplasmoz Insidansi." Mikrobioloji Bülteni, vol. 17, 1983, pp. 251-256.
21. Güngor, C., et al. "Immunsupresif Ilaç Alan Akut Lösemili Hastalarda Toxoplasma IgM, IgG ve Sabin Feldman Antikorlarının Araştırılması." Acta Parasitologica Turcica, vol. 17, 1993, pp. 21-26.
22. Chandran, R., et al. "Infections in Leukemia. Sepsis—An Ongoing and Significant Challenge." IntechOpen, 2021. https://www.intechopen.com/chapters/39664.
23. Dearden, C. "Disease-Specific Complications of Chronic Lymphocytic Leukemia." Hematology American Society of Hematology Education Program, 2008, pp. 450-456. https://doi.org/10.1182/asheducation-2008.1.450.
24. Zhu, Y.D., et al. "Abnormality of Serum Immunoglobulin in Peripheral Blood of Patients with Chronic Lymphocytic Leukemia." Zhongguo Shi Yan Xue Ye Xue Za Zhi, vol. 17, no. 5, 2009, pp. 1159-1162.
25. Görgün, G., et al. "Chronic Lymphocytic Leukemia Cells Induce Changes in Gene Expression of CD4 and CD8 T Cells." Journal of Clinical Investigation, vol. 115, no. 7, 2005, pp. 1797-1805. https://doi.org/10.1172/JCI24400.
26. Studeničová, C., et al. "Seroprevalence of Toxoplasma gondii Antibodies in a Healthy Population from Slovakia." European Journal of Internal Medicine, vol. 17, 2006, pp. 470-473. https://doi.org/10.1016/j.ejim.2006.05.008.
27. Dubey, J.P. "Source of Toxoplasma gondii in Pregnancy." BMJ, 2000, pp. 127-128. https://doi.org/10.1136/bmj.321.7254.127.